Mature sequence hsa-miR-492

Accession numberMIMAT0002812
IDhsa-miR-492
Stem-Loop hsa-mir-492
Sequence
aggaccugcgggacaagauucuu
Get sequence
Deep sequencing10 reads, 9 experiments
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).