Mature sequence hsa-miR-511-5p

Accession numberMIMAT0002808
IDhsa-miR-511-5p
Stem-Loop hsa-mir-511
Sequence
gugucuuuugcucugcaguca
Get sequence
Deep sequencing327 reads, 82 experiments
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).