Mature sequence mne-miR-215

Accession numberMIMAT0002736
IDmne-miR-215
Stem-Loop mne-mir-215
Sequence
augaccuaugaauugacagac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).