Mature sequence ppy-miR-181a-3p

Accession numberMIMAT0002627
IDppy-miR-181a-3p
Previous IDsppy-miR-213;ppy-miR-181a*
Stem-Loop ppy-mir-181a-1
Sequence
accaucgaccguugauuguacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).