Mature sequence mml-miR-223

Accession numberMIMAT0002588
IDmml-miR-223
Stem-Loop mml-mir-223
Sequence
ugucaguuugucaaauacccc
Get sequence
Deep sequencing821 reads, 9 experiments
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).