Mature sequence mml-miR-219

Accession numberMIMAT0002575
IDmml-miR-219
Stem-Loop mml-mir-219-1
Sequence
ugauuguccaaacgcaauucu
Get sequence
Deep sequencing1611 reads, 7 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).