Mature sequence ppy-miR-26a

Accession numberMIMAT0002346
IDppy-miR-26a
Stem-Loop ppy-mir-26a ppy-mir-26a-2
Sequence
uucaaguaauccaggauaggcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2