Mature sequence lla-miR-143

Accession numberMIMAT0002260
IDlla-miR-143
Stem-Loop lla-mir-143
Sequence
ugagaugaagcacuguagcuca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).