Mature sequence kshv-miR-K12-10b

Accession numberMIMAT0002180
IDkshv-miR-K12-10b
Stem-Loop kshv-mir-K12-10b
Sequence
ugguguuguccccccgaguggc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
6
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).