Mature sequence hsa-miR-483-3p

Accession numberMIMAT0002173
IDhsa-miR-483-3p
Previous IDshsa-miR-483
Stem-Loop hsa-mir-483
Sequence
ucacuccucuccucccgucuu
Get sequence
Deep sequencing7345 reads, 115 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).