Mature sequence ptc-miR478i

Accession numberMIMAT0002083
IDptc-miR478i
Stem-Loop ptc-MIR478i
Sequence
uaacgugucuccuauuuuuaggga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).