Mature sequence dre-miR-460-3p

Accession numberMIMAT0001888
IDdre-miR-460-3p
Stem-Loop dre-mir-460
Sequence
cacagcgcauacaauguggaug
Get sequence
Deep sequencing1841 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).