Mature sequence dre-miR-459-5p

Accession numberMIMAT0001886
IDdre-miR-459-5p
Previous IDsdre-miR-459
Stem-Loop dre-mir-459
Sequence
ucaguaacaaggauucauccug
Get sequence
Deep sequencing9 reads, 3 experiments
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).