Mature sequence dre-miR-455-5p

Accession numberMIMAT0001879
IDdre-miR-455-5p
Previous IDsdre-miR-455a
Stem-Loop dre-mir-455-1
Sequence
uaugugcccuuggacuacaucg
Get sequence
Deep sequencing3864 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).