Mature sequence dre-miR-146b

Accession numberMIMAT0001844
IDdre-miR-146b
Stem-Loop dre-mir-146b
Sequence
ugagaacugaauuccaagggug
Get sequence
Deep sequencing25998 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).