Mature sequence dre-miR-146a

Accession numberMIMAT0001843
IDdre-miR-146a
Stem-Loop dre-mir-146a
Sequence
ugagaacugaauuccauagaugg
Get sequence
Deep sequencing193388 reads, 10 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).