Mature sequence dre-miR-145-5p

Accession numberMIMAT0001842
IDdre-miR-145-5p
Previous IDsdre-miR-145
Stem-Loop dre-mir-145
Sequence
guccaguuuucccaggaauccc
Get sequence
Deep sequencing2870 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).