Mature sequence dre-miR-144-3p

Accession numberMIMAT0001841
IDdre-miR-144-3p
Previous IDsdre-miR-144
Stem-Loop dre-mir-144
Sequence
uacaguauagaugauguacu
Get sequence
Deep sequencing64 reads, 7 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).