Mature sequence dre-miR-143

Accession numberMIMAT0001840
IDdre-miR-143
Stem-Loop dre-mir-143 dre-mir-143-2
Sequence
ugagaugaagcacuguagcuc
Get sequence
Deep sequencing73255 reads, 11 experiments
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).