Mature sequence dre-miR-130b

Accession numberMIMAT0001827
IDdre-miR-130b
Stem-Loop dre-mir-130b
Sequence
cagugcaauaaugaaagggcau
Get sequence
Deep sequencing28302 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).