Mature sequence dre-miR-128-3p

Accession numberMIMAT0001824
IDdre-miR-128-3p
Previous IDsdre-miR-128
Stem-Loop dre-mir-128-1 dre-mir-128-2 dre-mir-128-3
Sequence
ucacagugaaccggucucuuuu
Get sequence
Deep sequencing16969 reads, 11 experiments

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).