Mature sequence dre-miR-125b-5p

Accession numberMIMAT0001821
IDdre-miR-125b-5p
Previous IDsdre-miR-125b
Stem-Loop dre-mir-125b-1 dre-mir-125b-2 dre-mir-125b-3
Sequence
ucccugagacccuaacuuguga
Get sequence
Deep sequencing62216 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).