Mature sequence dre-miR-124-3p

Accession numberMIMAT0001819
IDdre-miR-124-3p
Previous IDsdre-miR-124
Stem-Loop dre-mir-124-1 dre-mir-124-2 dre-mir-124-3 dre-mir-124-4 dre-mir-124-5 dre-mir-124-6
Sequence
uaaggcacgcggugaaugccaa
Get sequence
Deep sequencing29486 reads, 8 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).