Mature sequence dre-miR-107a-3p

Accession numberMIMAT0001817
IDdre-miR-107a-3p
Previous IDsdre-miR-107a
Stem-Loop dre-mir-107a
Sequence
agcagcauuguacagggcuauca
Get sequence
Deep sequencing29647 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).