Mature sequence dre-miR-101a

Accession numberMIMAT0001814
IDdre-miR-101a
Stem-Loop dre-mir-101a
Sequence
uacaguacugugauaacugaag
Get sequence
Deep sequencing20182 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).