Mature sequence dre-miR-30b

Accession numberMIMAT0001804
IDdre-miR-30b
Stem-Loop dre-mir-30b
Sequence
uguaaacauccuacacucagcu
Get sequence
Deep sequencing8812 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).