Mature sequence dre-miR-27d

Accession numberMIMAT0001799
IDdre-miR-27d
Stem-Loop dre-mir-27d
Sequence
uucacaguggcuaaguucuuca
Get sequence
Deep sequencing174845 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).