Mature sequence dre-miR-27c-3p

Accession numberMIMAT0001798
IDdre-miR-27c-3p
Previous IDsdre-miR-27c
Stem-Loop dre-mir-27c dre-mir-27c-2
Sequence
uucacagugguuaaguucugc
Get sequence
Deep sequencing178212 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).