Mature sequence dre-miR-23b

Accession numberMIMAT0001791
IDdre-miR-23b
Stem-Loop dre-mir-23b
Sequence
aucacauugccagggauuacca
Get sequence
Deep sequencing31707 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).