Mature sequence zma-miR169d

Accession numberMIMAT0001735
IDzma-miR169d
Stem-Loop zma-MIR169d
Sequence
uagccaaggagacugccuaug
Get sequence
Deep sequencing13 reads, 7 experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).