Mature sequence zma-miR166k-3p

Accession numberMIMAT0001719
IDzma-miR166k-3p
Previous IDszma-miR166k
Stem-Loop zma-MIR166k
Sequence
ucggaccaggcuucaaucccu
Get sequence
Deep sequencing148313 reads, 163 experiments
Database links
QuickGO function

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).