Mature sequence zma-miR399a-3p

Accession numberMIMAT0001704
IDzma-miR399a-3p
Previous IDszma-miR399a
Stem-Loop zma-MIR399a
Sequence
ugccaaaggagaauugcccug
Get sequence
Deep sequencing627 reads, 10 experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).