Mature sequence aga-miR-317

Accession numberMIMAT0001522
IDaga-miR-317
Stem-Loop aga-mir-317
Sequence
ugaacacaucuggugguaucucagu
Get sequence
Deep sequencing reads, experiments

References