Mature sequence ame-miR-276-3p

Accession numberMIMAT0001480
IDame-miR-276-3p
Stem-Loop ame-mir-276
Sequence
uaggaacuucauaccgugcucu
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).