Mature sequence sbi-miR166e

Accession numberMIMAT0001446
IDsbi-miR166e
Previous IDssbi-MIR166e
Stem-Loop sbi-MIR166e
Sequence
ucggaccaggcuucaaucccu
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).