Mature sequence hsa-miR-18b-5p

Accession numberMIMAT0001412
IDhsa-miR-18b-5p
Previous IDshsa-miR-18b
Stem-Loop hsa-mir-18b
Sequence
uaaggugcaucuagugcaguuag
Get sequence
Deep sequencing690346 reads, 155 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15944709 "c-Myc-regulated microRNAs modulate E2F1 expression" O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT Nature. 435:839-843(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).