Mature sequence zma-miR166f

Accession numberMIMAT0001380
IDzma-miR166f
Stem-Loop zma-MIR166f
Sequence
ucggaccaggcuucauuccc
Get sequence
Deep sequencing154357 reads, 144 experiments
Database links
QuickGO function

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).