Mature sequence ath-miR415

Accession numberMIMAT0001323
IDath-miR415
Stem-Loop ath-MIR415
Sequence
aacagagcagaaacagaacau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).