Mature sequence cbr-miR-360

Accession numberMIMAT0001303
IDcbr-miR-360
Stem-Loop cbr-mir-360
Sequence
ugaccguaaucccguucacaa
Get sequence
Deep sequencing reads, experiments

References

1