Mature sequence dre-miR-216a

Accession numberMIMAT0001284
IDdre-miR-216a
Previous IDsdre-miR-216
Stem-Loop dre-mir-216a
Sequence
uaaucucagcuggcaacuguga
Get sequence
Deep sequencing81 reads, 8 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).