Mature sequence dre-miR-192

Accession numberMIMAT0001275
IDdre-miR-192
Stem-Loop dre-mir-192
Sequence
augaccuaugaauugacagcc
Get sequence
Deep sequencing3325 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).