Mature sequence dre-miR-7a

Accession numberMIMAT0001266
IDdre-miR-7a
Previous IDsdre-miR-7
Stem-Loop dre-mir-7a-1 dre-mir-7a-2 dre-mir-7a-3
Sequence
uggaagacuagugauuuuguugu
Get sequence
Deep sequencing10824 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).