Mature sequence dps-miR-281

Accession numberMIMAT0001245
IDdps-miR-281
Stem-Loop dps-mir-281-1 dps-mir-281-2
Sequence
ugucauggaauugcucucuuugu
Get sequence
Deep sequencing reads, experiments

References