Mature sequence dps-miR-9c

Accession numberMIMAT0001213
IDdps-miR-9c
Stem-Loop dps-mir-9c
Sequence
ucuuugguauucuagcuguaga
Get sequence
Deep sequencing reads, experiments

References