Mature sequence gga-miR-205a

Accession numberMIMAT0001184
IDgga-miR-205a
Stem-Loop gga-mir-205a
Sequence
uccuucauuccaccggagucug
Get sequence
Deep sequencing185 reads, 5 experiments
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).