Mature sequence gga-miR-215-5p

Accession numberMIMAT0001134
IDgga-miR-215-5p
Stem-Loop gga-mir-215
Sequence
augaccuaugaauugacagac
Get sequence
Deep sequencing9557 reads, 5 experiments
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).