Mature sequence gga-miR-1a-3p

Accession numberMIMAT0001127
IDgga-miR-1a-3p
Previous IDsgga-miR-1
Stem-Loop gga-mir-1a-2 gga-mir-1a-1
Sequence
uggaauguaaagaaguaugua
Get sequence
Deep sequencing18225317 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).