Mature sequence gga-miR-15a

Accession numberMIMAT0001117
IDgga-miR-15a
Stem-Loop gga-mir-15a
Sequence
uagcagcacauaaugguuugu
Get sequence
Deep sequencing12994 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
3
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).