Mature sequence gga-miR-155

Accession numberMIMAT0001106
IDgga-miR-155
Stem-Loop gga-mir-155
Sequence
uuaaugcuaaucgugauagggg
Get sequence
Deep sequencing4075 reads, 5 experiments
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).