Mature sequence gga-miR-135a-5p

Accession numberMIMAT0001099
IDgga-miR-135a-5p
Stem-Loop gga-mir-135a-2 gga-mir-135a-1 gga-mir-135a-3
Sequence
uauggcuuuuuauuccuauguga
Get sequence
Deep sequencing75830 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).